Restricted-Use sequence

This sequence is only available under the Restricted Use Terms. This prohibits publications that use this sequence as focal data during the restricted-use period, except with the consent of the sequence submitters.
Display Name: Democratic_Republic_of_the_Congo/PP_004BH1P.1/2025-05-26
Nelson Mapenzi-Kashali, Andre Citenga, Placide Mbala-Kingebeni, Tony Wawina-Bokalanga, Eddy Kinganda-Lusamaki, Elisabeth Pukuta-Simbu, Emmanuel Hasivirwe-Vakaniaki, Rilia Ola-Mpumbe, Papy Kwete-Mbokama, Prince Akil-Bandali, Cris Kacita, Ange Ponga-Museme, Gloria Vakaniaki, Adrienne Amuri-Aziza, Kelly-Michel Kenye, Elisabeth Muyamuna, Sifa Kavira-Bapitani, Patrick Mukadi, Aine OToole, Olivier Tshiani-Mbaya, Princesse Paku-Tshambu, Emmanuel Lokilo-Lofiko, Chloe Muswamba-Kayembe, Jean-Claude Makangara-Cigolo, ..., Jean-Jacques Muyembe-Tamfum

Sample details

Collection date
2025-05-26
Country
Democratic Republic of the Congo
Admin level 1
Mongala

Data use terms

Data use terms
RESTRICTED

Clade & Lineage

Clade
Ia
Outbreak
None
Lineage
None

Authors

Author affiliations
Institut National de Recherche Biomédicale

Alignment and QC metrics

Length
187435
Completeness
88.66%
# of SNPs
726
# of inserted bases
2698
# of deleted bases
3030
# of ambiguous bases
6
# of unknown bases
12913
# of frame shifts
6
# of stop codons
0
Frame shifts
OPG003:4-589(nt:2841-4598),OPG047:477-483(nt:29746-29766),OPG050:71-76(nt:33181-33198),OPG164:229(nt:143460-143464),OPG180:556-560(nt:154356-154371),OPG191:167-169(nt:166658-166667)

Submission details

Submission ID
25MPX5041V
Submitting group
Date submitted
2025-10-21 09:27:59 UTC
Date released
2025-10-21 09:36:46 UTC
Earliest release date
2025-10-21

Nucleotide mutations

Mutations called relative to the NC_063383.1 reference

Substitutions

  • T466C
  • G475A
  • C630A
  • T720C
  • G749A
  • G907A
  • G994A
  • A1093G
  • C1201T
  • A1309G
  • G1319T
  • A1504G
  • A1687G
  • A1813C
  • T1814G
  • T2086G
  • C2391A
  • T2554C
  • Deletions
    458-460, 600-609, 2239-2241, 4693-4775, 6432, 6433, 7021-7026, 7148-7151, 7405, 8055, 8328, 8329, 8421-8424, 8471, 8499, 8919, 8993, 9242, 9243, 9282, 9529, 13276, 13353, 15549, 15550, 15747, 15872, 16608-16613, 18055-18057, 23171, 24310, 28590-28608, 32210-32212, 33199, 33414, 39076, 41935, 46506-46508, 46596, 47576, 47700, 47701, 48166-48168, 50500, 50501, 50575, 50576, 132813,...
    Insertions
    ins_631:GAGAGAA, ins_755:ACA, ins_1374:GGATACCTCATCATCTTC, ins_1697:A, ins_4598:T, ins_6256:TT, ins_6527:T, ins_6975:GTATAATCATCACTGTCGCTATCATTAT, ins_6983:T, ins_7435:GTA, ins_8602:ATATANNN, ins_9264:A, ins_9487:NNN, ins_9568:TT, ins_10453:TAGATTNNNNNNNNNNNNNNNNNNNNNGATTAGATTAGATTAGATTAGAT, ins_13297:TAGTTTCTATTTTTA, ins_16407:GTGT, ins_18902:GGCTGCCATGTATTTCCTGGAGAGCAAGTAGATGATGAGGA...

    Amino acid mutations

    Mutations called relative to the NC_063383.1 reference

    Substitutions

    OPG001

  • OPG001:T86N
  • OPG002

  • OPG002:A121S
  • OPG002:N313T
  • OPG015

  • OPG015:V4A
  • OPG015:L136F
  • OPG019

  • OPG019:M124R
  • OPG021

  • OPG021:V38I
  • OPG021:S219L
  • OPG021:K230R
  • OPG022

  • OPG022:G73D
  • OPG023

  • OPG023:A90V
  • OPG023:M109I
  • OPG023:V174A
  • OPG023:A193S
  • OPG023:S258L
  • OPG023:Y300H
  • OPG023:C304R
  • OPG023:V426T
  • OPG023:T488A
  • OPG023:L602I
  • OPG023:K637E
  • OPG024

  • OPG024:S32G
  • OPG025

  • OPG025:E393K
  • OPG025:I425V
  • OPG027

  • OPG027:I47V
  • OPG027:F79L
  • OPG027:V126I
  • OPG029

  • OPG029:C146R
  • OPG030

  • OPG030:N12D
  • OPG030:S113N
  • OPG031

  • OPG031:T80M
  • OPG031:D117E
  • OPG031:C241Y
  • OPG031:M271K
  • OPG034

  • OPG034:L205R
  • OPG036

  • OPG036:S11P
  • OPG036:D25E
  • OPG037

  • OPG037:C144Y
  • OPG037:C415R
  • OPG038

  • OPG038:H27P
  • OPG038:V78I
  • OPG039

  • OPG039:C279Y
  • OPG040

  • OPG040:P254A
  • OPG040:Y374S
  • OPG043

  • OPG043:T3A
  • OPG044

  • OPG044:V63A
  • OPG044:T109A
  • OPG044:M148L
  • OPG045

  • OPG045:A185T
  • OPG046

  • OPG046:S95N
  • OPG047

  • OPG047:I232K
  • OPG049

  • OPG049:E17V
  • OPG049:M37V
  • OPG049:T263M
  • OPG054

  • OPG054:R438G
  • OPG056

  • OPG056:V323A
  • OPG056:T602N
  • OPG056:C622Y
  • OPG059

  • OPG059:I26L
  • OPG063

  • OPG063:V307A
  • OPG064

  • OPG064:A88S
  • OPG065

  • OPG065:A17T
  • OPG065:N23D
  • OPG065:H61N
  • OPG066

  • OPG066:K83R
  • OPG066:H97N
  • OPG068

  • OPG068:P251S
  • OPG068:D341E
  • OPG070

  • OPG070:H205Y
  • OPG071

  • OPG071:L411W
  • OPG071:I428T
  • OPG071:A484S
  • OPG071:I501V
  • OPG072

  • OPG072:V10I
  • OPG074

  • OPG074:N199D
  • OPG074:I441V
  • OPG076

  • OPG076:S20N
  • OPG079

  • OPG079:C45Y
  • OPG080

  • OPG080:D321E
  • OPG080:C382S
  • OPG080:L521P
  • OPG080:P582H
  • OPG085

  • OPG085:S79T
  • OPG085:T328A
  • OPG089

  • OPG089:D303E
  • OPG089:E337K
  • OPG091

  • OPG091:V62I
  • OPG091:S73N
  • OPG092

  • OPG092:I244N
  • OPG094

  • OPG094:R175T
  • OPG096

  • OPG096:I68M
  • OPG100

  • OPG100:K152Q
  • OPG101

  • OPG101:T153A
  • OPG102

  • OPG102:I249V
  • OPG104

  • OPG104:T12A
  • OPG105

  • OPG105:V113G
  • OPG105:I1070V
  • OPG108

  • OPG108:V4A
  • OPG108:T111I
  • OPG109

  • OPG109:R364S
  • OPG109:A622T
  • OPG109:A630T
  • OPG111

  • OPG111:I77V
  • OPG112

  • OPG112:H34R
  • OPG113

  • OPG113:V537I
  • OPG117

  • OPG117:D454N
  • OPG118

  • OPG118:K256R
  • OPG118:N413S
  • OPG118:V462A
  • OPG118:K606E
  • OPG119

  • OPG119:T88R
  • OPG120

  • OPG120:A19T
  • OPG120:H213R
  • OPG123

  • OPG123:I172T
  • OPG123:A313T
  • OPG123:C436Y
  • OPG125

  • OPG125:E111D
  • OPG125:I514V
  • OPG130

  • OPG130:T63V
  • OPG130:T122A
  • OPG130:L270I
  • OPG134

  • OPG134:E226D
  • OPG135

  • OPG135:V90E
  • OPG136

  • OPG136:A229T
  • OPG136:D267N
  • OPG136:F283Y
  • OPG144

  • OPG144:T184I
  • OPG145

  • OPG145:I249V
  • OPG145:I264T
  • OPG145:A348P
  • OPG145:Q463R
  • OPG146

  • OPG146:C28Y
  • OPG148

  • OPG148:I313S
  • OPG150

  • OPG150:N100D
  • OPG150:D256E
  • OPG151

  • OPG151:D6V
  • OPG151:N282D
  • OPG153

  • OPG153:M14T
  • OPG153:R205H
  • OPG153:I355T
  • OPG153:Y358H
  • OPG153:Q493P
  • OPG154

  • OPG154:R74H
  • OPG154:H107R
  • OPG156

  • OPG156:Y42S
  • OPG156:T222A
  • OPG156:I261M
  • OPG157

  • OPG157:M24V
  • OPG159

  • OPG159:T2A
  • OPG159:L36S
  • OPG160

  • OPG160:P2S
  • OPG161

  • OPG161:K67E
  • OPG161:V88A
  • OPG163

  • OPG163:V46A
  • OPG164

  • OPG164:I111V
  • OPG164:Y217H
  • OPG165

  • OPG165:D106N
  • OPG165:S161L
  • OPG167

  • OPG167:Y107S
  • OPG167:I112V
  • OPG170

  • OPG170:G31D
  • OPG170:M111I
  • OPG172

  • OPG172:A125V
  • OPG172:M145T
  • OPG172:Y160D
  • OPG176

  • OPG176:D24N
  • OPG176:L227S
  • OPG181

  • OPG181:L85M
  • OPG181:S127Y
  • OPG187

  • OPG187:K300*
  • OPG188

  • OPG188:V265I
  • OPG188:S419R
  • OPG189

  • OPG189:K185R
  • OPG189:C506H
  • OPG191

  • OPG191:P50Q
  • OPG191:F80C
  • OPG192

  • OPG192:G100E
  • OPG193

  • OPG193:I108R
  • OPG195

  • OPG195:C120S
  • OPG199

  • OPG199:K230E
  • OPG200

  • OPG200:D52G
  • OPG200:E134G
  • OPG204

  • OPG204:N178K
  • OPG205

  • OPG205:W169R
  • OPG205:C349Y
  • OPG205:G354S
  • OPG205:V621A
  • OPG205:V690A
  • OPG205:R733Q
  • OPG208

  • OPG208:A34V
  • OPG210

  • OPG210:V173I
  • OPG210:K331N
  • OPG210:N334I
  • OPG210:H363R
  • OPG210:D379G
  • OPG210:V515A
  • OPG210:S781P
  • OPG210:V788A
  • OPG210:T928A
  • OPG210:N1600S
  • OPG210:L1704R
  • OPG210:D1717G
  • OPG210:E1863D
  • Deletions
    OPG002:172, OPG029:153, OPG029:154, OPG031:258, OPG049:314, OPG157:61, OPG164:228, OPG180:555, OPG191:166, OPG210:734
    Insertions
    ins_OPG001:74:DDEVSE, ins_OPG047:477:NGX, ins_OPG110:79:EEV, ins_OPG153:369:DDD, ins_OPG153:380:V, ins_OPG164:212:*, ins_OPG172:3:MMMM, ins_OPG189:31:NSS, ins_OPG205:736:QS

    Report an issue with this sequence or metadata

    Create GitHub issue